GATAATCTACACGAGCAGAATCATCAAAGCAAGATTACGATCTACGAGCATCGCATCGACTACAGCAT
CGCTACAGCTACGACTAGATAATCTAAGCAGAATCATCAACGACAGCAAGATTAGACTACGAGCATC
GCATCGACTACAGCATCGCTACAGCTACURETAGATAATCTACACGAGCAGAATCATCAAAGCAAGATTA
according to how well they work. Another way to
look at pricing is according to overall savings afforded by the treatment.
So, thinking about value and overall savings,
how do you price a one-time therapy that offers a
“cure” for HF? Is it of equal value to a lifetime of
polypharmacy that only offers symptom management? Is it more valuable?
It’s a topic that Dr. Reich from Renova Therapeutics is already thinking seriously about. When
asked in an interview by CSWN Executive Editor
Rick McGuire how the company might price RT100, the single-dose therapy designed to restore
heart function in HF patients, he said that Renova
is motivated first and foremost to save the health
care system money and ensure the treatment is accessible to patients.
To inform the company and the pubic of the
potential impact of RT-100, Renova is working with
the nonprofit RAND Health Advisory Services to do
an independent analysis that will reflect the health
care patterns of multiple advanced HF patients over
a 5-year period. Results of the modeling experiment are expected to be published in three separate
articles in major journals in the first half of 2016.
“We’re not interested in how much we could
charge or how much we defend,” said Dr. Reich in
the interview. “What we are interested in is to set
a price that people can afford. And demonstrate to
the health care system that the price could be multiple times higher, but we’re not trying to extract
the last dime. We’re trying to get the medicine truly
available to these patients that have this disease.”
Renova plans to take a similar approach with the
other therapy in their pipeline—a second-generation product for type 2 diabetes.
According to a blog post on Bioentrepreneur, a
Nature Biotechnology portal for scientists interested
in commercializing their research, pricing gene therapies will likely follow one of three general schemes:
the classic up-front, one-time payment; an annuity
model that spreads that payment over a number of
years to lessen the cost-density burden on payers
(think of it as a subscription to life); and a pay-forperformance, risk-sharing model that tracks patient
outcomes and rewards manufacturers for maintaining patients’ health over a period of time.
Said blogger Chris Morrison,4 from Yardley, PA,
“All gene therapies are unlikely to be deemed equal
in the eyes of payers.[…] But curative products that
are safe and have meaningful cost offsets, particularly in rare diseases, are likely to command record
prices in the not-too-distant future.”
Without a doubt, millions of HF patients are
hoping this theoretical issue becomes a real one very
soon. ■
REFERENCES:
1. Ma son D, Chen YZ, Krishnan HV, Sant S. J Control Release.
2015;215:101-11.
2. uniQure Announces Analysis of Six-Year Follow-up Data for
Glybera®. Available at uniqure.com/news/200/182/uniQureAnnounces-Analysis-of-Six-Year-Follow-up-Data-for-Glybera.
html. Accessed December 12, 2015.
3. van der Loo JC, Wright JF. Hum Mol Genet. 2015 Oct 30. pii:
ddv451 [Epub ahead of print]
4. Morrison C. Nat Biotechnol. 2015;33:217-8.
5. Ylä-Herttuala S. Mol Ther. 2015;23:217-8.
6. M Kitamura. “World’s most expensive medicine: Is it worth the
price?” Bloomberg Business. May 21, 2015.
7. Laflamme MA, Murry CE. Nature. 2011 May 19;473(7347):326-35.
8. Leri A, et al. Chapter 3. Cellular basis for myocardial regeneration and repair. Heart Failure: A companion to Braunwald’s
Heart Disease. 3rd edition. 2016. Mann DL and Felker GM, editors. (and) Bergmann O et al. Science. 2009; 324:98-102.
9. Sanganalmath SK, Bolli R. Circ Res 2013;113:810-34.
10. Jessup M, Greenberg B, Mancini D, et al. Circulation
2011;124:304-13.
11. Giacca M, Baker AH. Molecular Therapy. 2011;19:1181-2.
Precision Medicine
G
ene therapy is one thing, but there has been movement,
too, in the ancillary field of precision medicine.
With Celladon and Renova focusing on that giant called
heart failure, MyoKardia has turned their sights to using genetic
knowledge and a precision medicine approach to solve smaller
problems, namely heritable cardiomyopathies with known
genetic mutations in the sarcomere—the contractile apparatus
of the cell—as their underlying cause.
“For years we’ve been trying to figure out ways to treat
people who have these incredibly deleterious mutations and
diseases,” said MyoKardia cofounder Christine Seidman,
MD, in an interview with CSWN. Dr. Seidman is the director of
Christine Seidman, MD
CSWN talks with Christine Seidman, MD,
director of the Cardiovascular Genetics
Center at Brigham and Woman’s Hospital,
and professor of genetics and medicine at
Harvard Medical School, about fixing the
mutations that drive cardiomyopathy.
30 CardioSource WorldNews
the Cardiovascular Genetics Center at Brigham and Women’s
Hospital, Harvard Medical School, Boston, MA.
“We have been looking at symptoms and treating the
symptoms, but we’re not getting to the root of the problem. If
you know that a mutation drives a pathology, why not fix that
mutation?”
From this thinking and from their SHARE (Sarcomeric Human
Cardiomyopathy Registry) registry, one of the largest patient
registries with 8,000 cardiomyopathy patients in it, has come
MYK-461, an orally-administered small molecule, phase I treatment for hypertrophic cardiomyopathy. MYK-461 is a direct negative modulator of myosin, the motor protein of the sarcomere that
converts chemical energy into the contractile force. MyoKardia is
currently evaluating MYK-461 in multiple clinical trials.
MyoKardia has four founders, all of whom have extraordinary expertise to bring to the venture: Jonathan G.
Seidman, PhD, and Christine Seidman, MD, from Harvard
Medical School, were the first to describe a French Canadian
family about 25 years ago, demonstrating that this was an autosomal dominant heritable cardiomyopathy. Another founder,
James A Spudich, PhD, from Stanford University, has been
working on the fundamental mechanisms of muscle contraction his entire career, and the last founder, Leslie Leinwand,
PhD, from the University of Colorado, Boulder, CO, is also a
basic scientist with a keen interest in the genetic and molecular mechanisms of cardiovascular disease.
In 2014, MyoKardia partnered with Sanofi in a deal that paid
out $45 million up front and promised $200 million more. In late
October, MyoKardia went public at $10 a share, considered a discounted price driven by recent downturns in the biotech sector.
The biotech raised about $54 million—well below the predicted
Jonathan Fox, MD, PhD, and Tassos Gianakakos
MyoKardia CEO Tassos Gianakakos and
CMO Jonathan Fox, MD, PhD discuss
the first therapy to target the genetic
mutation that is the underlying cause of
cardiomyopathy.
$91.6 million it had hoped for.
Speaking to CSWN at ACC.15, MyoKardia CEO Tassos
Gianakakos said, “Right now, we’re getting very deep in understanding the disease drivers for cardiomyopathies in general that
are heritable. So that includes hypertrophic cardiomyopathy for
which MYK-461 is designed as well as dilated cardiomyopathy. So
look for us to advance a candidate in clinical development next
year (2016) around dilated cardiomyopathy.”
For more on cell therapy, please see the ACCEL article in this
issue of CSWN – “Regenerative Therapy: Stem Cells Generate
More Interest”. ■
January 2016