GATAATCTACACGAGCAGAATCATCAAAGCAAGATTACGCUREATCTACGACGCATCGACTACAGCAT
CGCTACAGCTACGACTAGATAATCTAAGCAGAATCATCAAAGCAAGATTAGACGCATTACGAGCATC
GCATCGACTACAGCATCGCTACAGCTACGACTAGATAATCTACACGAGCAGAATCATCAAAGCAAGATTA
would restore SERCA2a enzyme production in the
cardiomyocytes, which would then power the SR,
improving contraction and relaxation of remaining
cardiomyocytes.
In preclinical models of HF, increasing the
expression of SERCA2a in cardiomyocytes by gene
transfer restored normal calcium cycling and resulted in improved cardiac function and myocardial
energetics. The early phase II CUPID trial confirmed SERCA2a as an important target in HF and
showed that its pairing with an AAV1 and administration as a one-time antegrade epicardial infusion
was both safe in humans with advanced HF and
very likely clinically beneficial at the highest dose
tested (FIGURE 2).10 Just the fact that a gene therapy
for HF made it successfully through a phase II trial
was considered “by no means a minor achievement.”11 At this point, stock prices were looking
pretty healthy for Celladon…
Unfortunately, the phase IIb CUPID 2 trial
didn’t go so well. The trial enrolled 250 patients in
56 clinical sites and randomized them to Mydicar
or placebo in equal numbers. All patients were
prescreened for the presence of AAV neutralizing
antibodies.
The novel treatment failed to meet any of its
primary or secondary endpoints. Mydicar did not
reduce HF hospitalizations, all-cause death, or the
need for a mechanical circulatory device or heart
transplantation (FIGURE 3). Celladon stock collapsed
on the news.
When Celladon went public in early 2014, its
stock traded at $8/share. The month before the
CUPID 2 trial results were released (in April 2015),
the stock hit a high of about $28, falling to $13.68
the day before the results were revealed, and then
tanking at $2 when the bad news was confirmed.
In Nov. 2015, Celladon Corporation and Eiger
BioPharmaceuticals, Inc., a privately-held firm,
announced that they have entered into a definitive
merger agreement.
Renova Therapeutics
Renova Therapeutics is another hot gene therapy
start-up based in San Diego, CA, but of a very different flavor than Celladon and, obviously, hopeful
of a different future. The company is supported by
a group of high-net-worth individuals and has not
taken any venture capital money—as of yet. This
nonpublic route is by design, according
to Renova CEO, Jack W. Reich, PhD.
“When you’ve got individual investors, it’s quite different than venture
capital investors who are purely finanJack W. Reich,
PhD
cial investors,” explained Dr. Reich in
an interview with CSWN. “We’re not
sort of forced to go public or something like that
because we have investors that want to get liquid.
Our investors and our management are on the same
side of the table.”
They have partnered with the National Institutes
of Health (NIH) to run both an extensive preclinical
ACC.org/CSWN
program on their target gene therapy product and
to conduct clinical trials through a public-private
partnership between the NIH and Renova Therapeutics.
Renova’s scientific founder is Kirk H. Hammond, MD, from the University of California San
Diego. Dr. Hammond was the first to discover that
adenylyl cyclase type 6 (AC6) was downregulated in
patients with HF of any etiology and that regulating
AC6 could have a positive effect on said patients.
AC6 is a protein found in cardiomyocytes that
catalyzed conversion of adenosine triphosphate to
cyclic AMP (cAMP) and, thus, is a central regulator of calcium cycling. As it happens, AC6 also
improves the affinity of SERCA2a for calcium by
activating a cAMP-dependent protein kinase of
phospholamban, placing it upstream from SERCA2a and possibly explaining its greater efficacy (at
least at this point in the development cycle).
“[SERCA2a] does not have the effect of normalizing heart function,” said Dr. Reich about SERCA2a. “They thought that it would improve calcium
handling, but the results speak for themselves.” He
also questioned whether AAV1 was the optimal
vector for this therapy, noting that Renova’s adenovirus vector when delivered by catheter directly
into the coronary arteries “causes the heart to take
up the gene therapy like a sponge.”
“You get extraordinarily high yield gene transfer
and, as a result, you get extraordinary production
of the protein the gene produces and then the effects that we have now demonstrated in the clinic.”
RT-100 is designed to upregulate AC6 content
and restore heart function. In extensive preclinical
study, a single dose improved myocardial function
and reversed HF-induced remodeling of the heart.
These early results supported the phase II trial conducted at seven U.S. centers and presented by Dr.
Hammond during a Clinical Trial Update session at
the 2015 European Society of Cardiology meeting
in London.
In the study, 56 patients with HF with reduced
ejection fraction (HFrEF) were randomly assigned
to one of six dose groups of RT-100. During the
1-year trial, there were no differences in HF hospitalization or death between groups. AC6 gene
transfer was not associated with myocarditis or
liver inflammation, or an increase in implantable
cardioverter-defibrillator events.
In terms of efficacy, RT-100 given at the two
highest doses increased EF significantly at 4 weeks,
but because of an insignificant but substantial
increase in the placebo group at 4 weeks, the
between-group difference was not significant at 12
weeks. When the investigators looked at EF change
> 5 units, eight of 21 individual 2v